Skip to main content
Addgene
Open Menu

pEGFP Kind2 S159/181/666A
(Plasmid #105310)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105310 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 105310-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 105310-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-NV
  • Backbone manufacturer
    modified pEGFP-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kindlin2
  • Alt name
    FERMT2
  • Alt name
    fermitin family member 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2100
  • Mutation
    S159/181/666A
  • GenBank ID
    NM_006832
  • Entrez Gene
    FERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer GGGAAAAGAAGAGAACTTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutations in Kindlin2 were introduced by using site-directed mutagenesis (Stratagene)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP Kind2 S159/181/666A was a gift from Kenneth Yamada (Addgene plasmid # 105310 ; http://n2t.net/addgene:105310 ; RRID:Addgene_105310)

  • For your References section:

    Dense fibrillar collagen is a potent inducer of invadopodia via a specific signaling network. Artym VV, Swatkoski S, Matsumoto K, Campbell CB, Petrie RJ, Dimitriadis EK, Li X, Mueller SC, Bugge TH, Gucek M, Yamada KM. J Cell Biol. 2015 Feb 2;208(3):331-50. doi: 10.1083/jcb.201405099. 10.1083/jcb.201405099 PubMed 25646088
Related items:
Commonly requested with: