-
PurposeT7 promotor drives in vitro mRNA transcription of a mEGFP-tagged membrane reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105526 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEMHE
- Backbone size w/o insert (bp) 3112
- Total vector size (bp) 3889
-
Vector typein vitro Transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGNAI2
-
Alt nameGIPB
-
Alt nameH_LUCA15.1
-
Alt nameH_LUCA16.1
-
SpeciesH. sapiens (human)
-
Mutationfragment encoding the plasma membrane targeting sequence (’Membrane’) from Human GNAI2 consisting of the N-terminal amino acids 1-15 (nt 1-45) (which includes N-myristol and S-palmitoyl motifs for targeting and retention at plasma mebrane) in frame with mEGFP
-
GenBank IDNC_000003.12
-
Entrez GeneGNAI2 (a.k.a. GIP, GNAI2B, HG1C, H_LUCA15.1, H_LUCA16.1)
- Promoter T7
-
Tag
/ Fusion Protein
- mEGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AAGGCGATTAAGTTGGGTAACG
- 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-membrane-mEGFP was a gift from Melina Schuh (Addgene plasmid # 105526 ; http://n2t.net/addgene:105526 ; RRID:Addgene_105526) -
For your References section:
A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837