Skip to main content

pGEMHE-membrane-mEGFP
(Plasmid #105526)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105526 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEMHE
  • Backbone size w/o insert (bp) 3112
  • Total vector size (bp) 3889
  • Vector type
    in vitro Transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GNAI2
  • Alt name
    GIPB
  • Alt name
    H_LUCA15.1
  • Alt name
    H_LUCA16.1
  • Species
    H. sapiens (human)
  • Mutation
    fragment encoding the plasma membrane targeting sequence (’Membrane’) from Human GNAI2 consisting of the N-terminal amino acids 1-15 (nt 1-45) (which includes N-myristol and S-palmitoyl motifs for targeting and retention at plasma mebrane) in frame with mEGFP
  • GenBank ID
    NC_000003.12
  • Entrez Gene
    GNAI2 (a.k.a. GIP, GNAI2B, HG1C, H_LUCA15.1, H_LUCA16.1)
  • Promoter T7
  • Tag / Fusion Protein
    • mEGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AAGGCGATTAAGTTGGGTAACG
  • 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHE-membrane-mEGFP was a gift from Melina Schuh (Addgene plasmid # 105526 ; http://n2t.net/addgene:105526 ; RRID:Addgene_105526)
  • For your References section:

    A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837