-
PurposeT7 promotor drives in vitro mRNA transcription of a mEGFP with a nuclear localisation signal
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105527 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEMHE
- Backbone size w/o insert (bp) 3819
- Total vector size (bp) 3898
-
Vector typein vitro Transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNucleoplasmin
-
Insert Size (bp)69
-
MutationNLS of nucleoplasmin (encoding amino acids KRPAATKKAGQAKKKKL)
- Promoter T7
-
Tag
/ Fusion Protein
- mEGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer AAGGCGATTAAGTTGGGTAACG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-NLS-mEGFP was a gift from Melina Schuh (Addgene plasmid # 105527 ; http://n2t.net/addgene:105527 ; RRID:Addgene_105527) -
For your References section:
A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837