pFUSEss-CHIg-mG1_CH3-3
(Plasmid
#105853)
-
PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH3.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFUSEss-CHIg-mG1 (modified)
-
Backbone manufacturerInvivogen
- Backbone size w/o insert (bp) 4480
- Total vector size (bp) 4835
-
Modifications to backbonehybrid heavy chain of mouse IgG1 with CH3 derived from mouse IgG3
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIgG1 heavy chain, IgG3 heavy chain
-
Alt nameIghg1
-
Alt nameIghg3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)355
-
Mutationhybrid heavy chain of mouse IgG1 with CH3 derived from mouse IgG3
-
Entrez GeneIghg1 (a.k.a. IgG1, Igh-4, VH7183)
-
Entrez GeneIghg3 (a.k.a. IgG3)
- Promoter hEF1-HTLV prom
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site AfeI (not destroyed)
- 5′ sequencing primer ATGTACAGGATGCAACTCCTG
- 3′ sequencing primer EBV-rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUSEss-CHIg-mG1_CH3-3 was a gift from Joanna Bereta (Addgene plasmid # 105853 ; http://n2t.net/addgene:105853 ; RRID:Addgene_105853) -
For your References section:
CH2 Domain of Mouse IgG3 Governs Antibody Oligomerization, Increases Functional Affinity to Multivalent Antigens and Enhances Hemagglutination. Klaus T, Bereta J. Front Immunol. 2018 May 23;9:1096. doi: 10.3389/fimmu.2018.01096. eCollection 2018. 10.3389/fimmu.2018.01096 PubMed 29875771