Skip to main content
Addgene
Open Menu

Opto-D1R
(Plasmid #106067)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106067 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 106067-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 106067-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1-
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5427
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Opto-D1R
  • Species
    M. musculus (mouse), B. taurus (bovine)
  • Insert Size (bp)
    1482
  • Mutation
    Chimeric receptor protein
  • Promoter CMV
  • Tags / Fusion Proteins
    • VSV-G (N terminal on insert)
    • Rhodopsin-1D4 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CMV_F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer pcDNA_R (CAACAGATGGCTGGCAAC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

two step cloning; 5' and 3' sites cannot be used for (sub)cloning

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Opto-D1R was a gift from Harald Janovjak (Addgene plasmid # 106067 ; http://n2t.net/addgene:106067 ; RRID:Addgene_106067)

  • For your References section:

    Optical functionalization of human Class A orphan G-protein-coupled receptors. Morri M, Sanchez-Romero I, Tichy AM, Kainrath S, Gerrard EJ, Hirschfeld PP, Schwarz J, Janovjak H. Nat Commun. 2018 May 16;9(1):1950. doi: 10.1038/s41467-018-04342-1. 10.1038/s41467-018-04342-1 PubMed 29769519
Related items:
Commonly requested with: