hMLKL NB(1-140)-2xFv-flag
(Plasmid
#106074)
-
Purposeexpression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRetrX-TRE3G
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 7793
-
Vector typeMammalian Expression, Retroviral ; Tet-On retrovirus
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman MLKL NB(1-140)-2xFv-flag
-
Alt nameoligomerizable MLKL N-terminal Bundle
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1231
-
Mutationamino acids 1-140
-
GenBank IDNM_152649.3
-
Entrez GeneMLKL (a.k.a. hMLKL)
- Promoter Dox-inducible
-
Tag
/ Fusion Protein
- flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer gcggccgcaggcgtccaagtcgaaaccatt
- 3′ sequencing primer gcggccgcttccagttttagaagctccac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hMLKL NB(1-140)-2xFv-flag was a gift from Douglas Green (Addgene plasmid # 106074 ; http://n2t.net/addgene:106074 ; RRID:Addgene_106074) -
For your References section:
Sequential Engagement of Distinct MLKL Phosphatidylinositol-Binding Sites Executes Necroptosis. Quarato G, Guy CS, Grace CR, Llambi F, Nourse A, Rodriguez DA, Wakefield R, Frase S, Moldoveanu T, Green DR. Mol Cell. 2016 Feb 18;61(4):589-601. doi: 10.1016/j.molcel.2016.01.011. Epub 2016 Feb 4. 10.1016/j.molcel.2016.01.011 PubMed 26853145