Skip to main content

hMLKL NB(1-182)-2xFv-flag
(Plasmid #106075)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106075 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRetrX-TRE3G
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 7919
  • Vector type
    Mammalian Expression, Retroviral ; Tet-On retrovirus
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human MLKL NB(1-182)-2xFv-flag
  • Alt name
    oligomerizable MLKL N-terminal Bundle Brace
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1357
  • Mutation
    amino acids 1-182
  • GenBank ID
    NM_152649.3
  • Entrez Gene
    MLKL (a.k.a. hMLKL)
  • Promoter Dox-inducible
  • Tag / Fusion Protein
    • flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer gcggccgcaggcgtccaagtcgaaaccatt
  • 3′ sequencing primer gcggccgcttccagttttagaagctccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hMLKL NB(1-182)-2xFv-flag was a gift from Douglas Green (Addgene plasmid # 106075 ; http://n2t.net/addgene:106075 ; RRID:Addgene_106075)
  • For your References section:

    Sequential Engagement of Distinct MLKL Phosphatidylinositol-Binding Sites Executes Necroptosis. Quarato G, Guy CS, Grace CR, Llambi F, Nourse A, Rodriguez DA, Wakefield R, Frase S, Moldoveanu T, Green DR. Mol Cell. 2016 Feb 18;61(4):589-601. doi: 10.1016/j.molcel.2016.01.011. Epub 2016 Feb 4. 10.1016/j.molcel.2016.01.011 PubMed 26853145