Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hMLKL-Venus-Mito
(Plasmid #106080)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 106080 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRetrX-TRE3G
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 8804
  • Vector type
    Mammalian Expression, Retroviral ; Tet-On retrovirus
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hMLKL-Venus-Mito
  • Alt name
    mitochondrial-targeted human MLKL
  • Alt name
    hMLKL-Venus-OMM BclXL
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2242
  • GenBank ID
    NM_152649.3
  • Entrez Gene
    MLKL (a.k.a. hMLKL)
  • Promoter Dox-inducible
  • Tag / Fusion Protein
    • mitochondrial-targetting domain of Bcl-xl (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ACCATGGAAAATTTGAAGCAT
  • 3′ sequencing primer GAATTCTCATTTCCGACTGAAGAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hMLKL-Venus-Mito was a gift from Douglas Green (Addgene plasmid # 106080 ; http://n2t.net/addgene:106080 ; RRID:Addgene_106080)
  • For your References section:

    Sequential Engagement of Distinct MLKL Phosphatidylinositol-Binding Sites Executes Necroptosis. Quarato G, Guy CS, Grace CR, Llambi F, Nourse A, Rodriguez DA, Wakefield R, Frase S, Moldoveanu T, Green DR. Mol Cell. 2016 Feb 18;61(4):589-601. doi: 10.1016/j.molcel.2016.01.011. Epub 2016 Feb 4. 10.1016/j.molcel.2016.01.011 PubMed 26853145