pUPD2:SF35
(Plasmid
#106216)
-
PurposeProvides short stuffer fragment of 35bp as a level 0 GoldenBraid part
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUPD1
-
Backbone manufacturerGoldenBraid kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
- Backbone size w/o insert (bp) 3055
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshort stuffer fragment of 35bp
-
Alt nameSf1
-
Insert Size (bp)35
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CCCGATCAACTCGAGTGCCA
- 3′ sequencing primer GAGGAAGCCTGCATAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUPD2:SF35 was a gift from Tomáš Moravec (Addgene plasmid # 106216 ; http://n2t.net/addgene:106216 ; RRID:Addgene_106216)