Skip to main content

pUPD2:35S-TMV-Rep-MP
(Plasmid #106217)

  • Purpose
    Provides CaMV 35S and 5' part of Tobacco mosaic virus (RdRp polymerase with intron, movement protein and sgCP promoter) as level 0 GoldenBraid part (GGAG-AATG)
  • Depositing Lab
  • Depositing Organization
    Academy of Sciences of the Czech Republic
    Located in the Czech Republic
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106217 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pUPD2
  • Backbone manufacturer
    GoldenBraid kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Infectious clone of Tobacco mosaic virus, 5' part
  • Alt name
    TMV
  • Alt name
    viral expression vector
  • Species
    Synthetic
  • Insert Size (bp)
    6622
  • Mutation
    BsaI and BsmBI sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CCCGATCAACTCGAGTGCCA
  • 3′ sequencing primer GAGGAAGCCTGCATAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUPD2:35S-TMV-Rep-MP was a gift from Tomáš Moravec (Addgene plasmid # 106217 ; http://n2t.net/addgene:106217 ; RRID:Addgene_106217)