-
PurposeLuciferase lentivirus based enhancer assay vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLS-mP
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 8750
-
Vector typeLentiviral, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuciferase
-
SpeciesFirefly
-
Insert Size (bp)1700
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTCTTGTGTATATCCGGTC
- 3′ sequencing primer AAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is an anti-repressor element (called #40) between the BstXI and XbaI, which prevents the expression cassette from position effect. See the manually annotated plasmid map for pLS-mP (https://www.addgene.org/81225/) Please use XbaI and/or SbfI for enhancer cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLS-mP-Luc was a gift from Nadav Ahituv (Addgene plasmid # 106253 ; http://n2t.net/addgene:106253 ; RRID:Addgene_106253)