Skip to main content

Phi3-GCaMP6f
(Plasmid #106298)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106298 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PLVX Puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8151
  • Total vector size (bp) 9504
  • Modifications to backbone
    MCS was modified as described in Takacs, C.N., et al., (2017) Traffic 18, 192-204.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Alt name
    GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
  • Alt name
    GCaMP3 variant 693
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
    1353
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (GCaMP6f) and BamHI (Phi3) (destroyed during cloning)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCGCATGCTCCAGACTGCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6f was from Douglas Kim, Addgene plasmid # 40755

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Phi3-GCaMP6f was a gift from Sanford Simon (Addgene plasmid # 106298 ; http://n2t.net/addgene:106298 ; RRID:Addgene_106298)
  • For your References section:

    Ca2+ transients in melanocyte dendrites and dendritic spine-like structures evoked by cell-to-cell signaling. Belote RL, Simon SM. J Cell Biol. 2020 Jan 6;219(1). pii: 132739. doi: 10.1083/jcb.201902014. 10.1083/jcb.201902014 PubMed 31821412