pRAB18-GFP
(Plasmid
#106984)
-
PurposeABA signaling reporter, GFP under the RAB18 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBI101
- Total vector size (bp) 14231
-
Vector typePlant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesGFP
- Promoter RAB18
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer cagctatgaccatgattacgcc
- 3′ sequencing primer gacgttgtaaaacgacggccagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRAB18-GFP was a gift from Julian Schroeder (Addgene plasmid # 106984 ; http://n2t.net/addgene:106984 ; RRID:Addgene_106984) -
For your References section:
Chemical genetics reveals negative regulation of abscisic acid signaling by a plant immune response pathway. Kim TH, Hauser F, Ha T, Xue S, Bohmer M, Nishimura N, Munemasa S, Hubbard K, Peine N, Lee BH, Lee S, Robert N, Parker JE, Schroeder JI. Curr Biol. 2011 Jun 7;21(11):990-7. doi: 10.1016/j.cub.2011.04.045. Epub 2011 May 27. 10.1016/j.cub.2011.04.045 PubMed 21620700