-
PurposeModified Luciferase expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD274
-
Alt namePD-L1, B7-H1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)718
-
MutationN.B. There are two published SNPs in this region of the H. sapiens genome sequence
-
Entrez GeneCD274 (a.k.a. B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer TTTAAAGCAAGTAAAACCTC
- 3′ sequencing primer GAGCTGACTGGGTTGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3 1 kb prom. + Enhancer CD274 was a gift from Julian Downward (Addgene plasmid # 107005 ; http://n2t.net/addgene:107005 ; RRID:Addgene_107005) -
For your References section:
Oncogenic RAS Signaling Promotes Tumor Immunoresistance by Stabilizing PD-L1 mRNA. Coelho MA, de Carne Trecesson S, Rana S, Zecchin D, Moore C, Molina-Arcas M, East P, Spencer-Dene B, Nye E, Barnouin K, Snijders AP, Lai WS, Blackshear PJ, Downward J. Immunity. 2017 Dec 19;47(6):1083-1099.e6. doi: 10.1016/j.immuni.2017.11.016. Epub 2017 Dec 12. 10.1016/j.immuni.2017.11.016 PubMed 29246442