Skip to main content

pGL3 1 kb prom. + Enhancer CD274
(Plasmid #107005)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107005 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD274
  • Alt name
    PD-L1, B7-H1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    718
  • Mutation
    N.B. There are two published SNPs in this region of the H. sapiens genome sequence
  • Entrez Gene
    CD274 (a.k.a. B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer ‎TTTAAAGCAAGTAAAACCTC
  • 3′ sequencing primer GAGCTGACTGGGTTGAAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3 1 kb prom. + Enhancer CD274 was a gift from Julian Downward (Addgene plasmid # 107005 ; http://n2t.net/addgene:107005 ; RRID:Addgene_107005)
  • For your References section:

    Oncogenic RAS Signaling Promotes Tumor Immunoresistance by Stabilizing PD-L1 mRNA. Coelho MA, de Carne Trecesson S, Rana S, Zecchin D, Moore C, Molina-Arcas M, East P, Spencer-Dene B, Nye E, Barnouin K, Snijders AP, Lai WS, Blackshear PJ, Downward J. Immunity. 2017 Dec 19;47(6):1083-1099.e6. doi: 10.1016/j.immuni.2017.11.016. Epub 2017 Dec 12. 10.1016/j.immuni.2017.11.016 PubMed 29246442