Skip to main content
Addgene

Flag-hPKL WT
(Plasmid #107159)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107159 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLHCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6819
  • Total vector size (bp) 8477
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Flag-hPKL WT
  • Alt name
    PKL
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1658
  • Entrez Gene
    PKLR (a.k.a. CNSHA2, PK1, PKL, PKRL, RPK)
  • Promoter CMV
  • Tag / Fusion Protein
    • N-term Flag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer agctcgtttagtgaaccgtcagatc
  • 3′ sequencing primer acctacaggtggggtctttcattccc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-hPKL WT was a gift from Jesse Rinehart (Addgene plasmid # 107159 ; http://n2t.net/addgene:107159 ; RRID:Addgene_107159)
  • For your References section:

    Distinct Hepatic PKA and CDK Signaling Pathways Control Activity-Independent Pyruvate Kinase Phosphorylation and Hepatic Glucose Production. Gassaway BM, Cardone RL, Padyana AK, Petersen MC, Judd ET, Hayes S, Tong S, Barber KW, Apostolidi M, Abulizi A, Sheetz JB, Kshitiz, Aerni HR, Gross S, Kung C, Samuel VT, Shulman GI, Kibbey RG, Rinehart J. Cell Rep. 2019 Dec 10;29(11):3394-3404.e9. doi: 10.1016/j.celrep.2019.11.009. 10.1016/j.celrep.2019.11.009 PubMed 31825824