-
PurposeExpresses Cas9 upon induction with doxicycline.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN/A
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehSpCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4101
- Promoter TRE
-
Tags
/ Fusion Proteins
- 3xFlag (N terminal on insert)
- Nucleoplasmin NLS (C terminal on insert)
- SV40 NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GTAAAACGACGGCCAGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namertTA
-
Insert Size (bp)747
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer caattacggggtcattagttcatag
- 3′ sequencing primer gggagcatgtcaaggtcaaaatc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namebGH polyA-SV40polyA
-
Insert Size (bp)416
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byPuro-Cas9 donor vector (Addgene #58409)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA was a gift from Pablo Menéndez (Addgene plasmid # 107270 ; http://n2t.net/addgene:107270 ; RRID:Addgene_107270) -
For your References section:
Generation and characterization of a human iPSC cell line expressing inducible Cas9 in the "safe harbor" AAVS1 locus. Castano J, Bueno C, Jimenez-Delgado S, Roca-Ho H, Fraga MF, Fernandez AF, Nakanishi M, Torres-Ruiz R, Rodriguez-Perales S, Menendez P. Stem Cell Res. 2017 May;21:137-140. doi: 10.1016/j.scr.2017.04.011. Epub 2017 Apr 22. 10.1016/j.scr.2017.04.011 PubMed 28677529