Skip to main content

pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA
(Plasmid #107270)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107270 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N/A
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    hSpCas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4101
  • Promoter TRE
  • Tags / Fusion Proteins
    • 3xFlag (N terminal on insert)
    • Nucleoplasmin NLS (C terminal on insert)
    • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    rtTA
  • Insert Size (bp)
    747
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer caattacggggtcattagttcatag
  • 3′ sequencing primer gggagcatgtcaaggtcaaaatc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    bGH polyA-SV40polyA
  • Insert Size (bp)
    416

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA was a gift from Pablo Menéndez (Addgene plasmid # 107270 ; http://n2t.net/addgene:107270 ; RRID:Addgene_107270)
  • For your References section:

    Generation and characterization of a human iPSC cell line expressing inducible Cas9 in the "safe harbor" AAVS1 locus. Castano J, Bueno C, Jimenez-Delgado S, Roca-Ho H, Fraga MF, Fernandez AF, Nakanishi M, Torres-Ruiz R, Rodriguez-Perales S, Menendez P. Stem Cell Res. 2017 May;21:137-140. doi: 10.1016/j.scr.2017.04.011. Epub 2017 Apr 22. 10.1016/j.scr.2017.04.011 PubMed 28677529