cacnb4 (rat) in pMT2 vector
(Plasmid #107426)

• Purpose: Expresses Calcium channel beta4 auxillary subunit in mammalian cells
• Depositing Lab: Annette Dolphin
• Depositing Organization: University College London
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: Brodbeck et al J Biol Chem. 2002 Mar 8;277(10):7684-93. doi: 10.1074/jbc.M109404200. Epub 2001 Dec 26.
• Citations: 3 Articles

Backbone

• Vector backbone: pMT2
• Backbone manufacturer: Genetics Institute, Inc, Cambridge, MA, USA
• Backbone size w/o insert (bp): 5163
• Total vector size (bp): 9114
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cacnb4
• Alt name: calcium channel beta4 subunit
• Species: R. norvegicus (rat)
• Insert Size (bp): 3953
• GenBank ID: L02315
• Entrez Gene: Cacnb4 (a.k.a. CAB4)
• Promoter: Ad MLP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: AGCTTGAGGTGTGGCAGGCTT
• 3′ sequencing primer: GGTCGAACCATGATGGCAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr Edward Perez-Reyes,Stritch School of Medicine, Dept of Physiology, Loyola University Chicago, Illinois, USA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We received it in pBluescript and subcloned it into pMT2 plasmid.

DNA (Catalog # 107426-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 107426-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.