FoxFTVC+bpFOG_Cdkn1b.a
              
              
                (Plasmid
                
                #107523)
              
            
            
            
          - 
            PurposeNegative regulator of cell cycle progression by G1/S transition inhibition
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCESA
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 3632
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameCdkn1b.a
- 
                  Alt nameCdkn1b (G1/S transition inhibitor)
- 
                  Insert Size (bp)489
- Promoter TVC-specific FoxF enhancer (FoxFTVC+bpFOG)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer cattaacctataaaaataggcgtatca
- 3′ sequencing primer ggatttccttacgcgaaatacg (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: FoxFTVC+bpFOG_Cdkn1b.a was a gift from Lionel Christiaen (Addgene plasmid # 107523 ; http://n2t.net/addgene:107523 ; RRID:Addgene_107523)
- 
                For your References section: An FGF-driven feed-forward circuit patterns the cardiopharyngeal mesoderm in space and time. Razy-Krajka F, Gravez B, Kaplan N, Racioppi C, Wang W, Christiaen L. Elife. 2018 Feb 6;7. pii: 29656. doi: 10.7554/eLife.29656. PubMed 29431097
 
    
