Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPLtetO-FtsB
(Plasmid #107559)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107559 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJKR-L-tetR
  • Modifications to backbone
    Replaced GFP with FtsZ
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BW 25113
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ftsB
  • Alt name
    ECK2743
  • Alt name
    JW2718
  • Alt name
    ygbQ
  • Species
    Escherichia coli
  • Insert Size (bp)
    312
  • GenBank ID
  • Promoter pLtetO

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGGACAAATCCGCCGGGAG
  • 3′ sequencing primer GGGTTGTTAAACCTTCGATTCCGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/05/04/314922 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPLtetO-FtsB was a gift from Uwe Sauer (Addgene plasmid # 107559 ; http://n2t.net/addgene:107559 ; RRID:Addgene_107559)
  • For your References section:

    Synthesis and degradation of FtsZ quantitatively predict the first cell division in starved bacteria. Sekar K, Rusconi R, Sauls JT, Fuhrer T, Noor E, Nguyen J, Fernandez VI, Buffing MF, Berney M, Jun S, Stocker R, Sauer U. Mol Syst Biol. 2018 Nov 5;14(11):e8623. doi: 10.15252/msb.20188623. 10.15252/msb.20188623 PubMed 30397005