pTU1-A-fbp_RiboJ_GFP+_MGApt_Bba_B0015
(Plasmid
#107578)
-
PurposeB. megaterium DSM319 fbp promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTU1-A - EcoFlex (Moore et al, 2016 - PubMed PMID: 27096716)
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 6336
- Total vector size (bp) 7074
-
Modifications to backboneEcoFlex backbone (AmpR + pMB1) and Bacillus origin of replication (rebM) and tetracycline resistance (tetA)
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Tetracycline, 100 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions100 ug/ml ampicillin in E. coli 5 ug/ml tetracycline in Bacillus
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP+
-
Alt nameGFPuv3
-
SpeciesSynthetic
-
Insert Size (bp)738
-
MutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163A
- Promoter fbp promoter Bacillus megaterium DSM319
-
Tag
/ Fusion Protein
- B. megaterium DSM319 xylA leader sequence (MTSSKIW) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site See Moore et al, 2016 - PubMed PMID: 27096716 (destroyed during cloning)
- 3′ cloning site EcoFlex assembly (destroyed during cloning)
- 5′ sequencing primer BM_VF; gctttcgctaaggatgatttctg
- 3′ sequencing primer BM_VR; cgaaagggcctcgtgatac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr Rebekka Biedendieck and Professor Dieter Jahn - Braunschweig Technical University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTU1-A-fbp_RiboJ_GFP+_MGApt_Bba_B0015 was a gift from Paul Freemont (Addgene plasmid # 107578 ; http://n2t.net/addgene:107578 ; RRID:Addgene_107578) -
For your References section:
Rapid acquisition and model-based analysis of cell-free transcription-translation reactions from nonmodel bacteria. Moore SJ, MacDonald JT, Wienecke S, Ishwarbhai A, Tsipa A, Aw R, Kylilis N, Bell DJ, McClymont DW, Jensen K, Polizzi KM, Biedendieck R, Freemont PS. Proc Natl Acad Sci U S A. 2018 Apr 17. pii: 1715806115. doi: 10.1073/pnas.1715806115. 10.1073/pnas.1715806115 PubMed 29666238