Skip to main content
Addgene
Open Menu

pN3-Sp2FL
(Plasmid #107718)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107718 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 107718-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 107718-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pN3
  • Backbone manufacturer
    Guntram Suske (Addgene plasmid # 24544)
  • Backbone size w/o insert (bp) 3996
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sp2
  • Alt name
    Sp2 transcription factor
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2963
  • Entrez Gene
    Sp2 (a.k.a. mKIAA0048, 4930480I16Rik)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CMV-for (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer SV40-pA-rev (CCTCACAAATGTGGTATGG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is related to the Addgene plasmids pN3-Sp1FL (#24543), pN3-Sp3FL (#24541) and pN3-Control (#24544)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN3-Sp2FL was a gift from Guntram Suske (Addgene plasmid # 107718 ; http://n2t.net/addgene:107718 ; RRID:Addgene_107718)
Related items:
Commonly requested with: