mmu-miR-30a-5p Block-iT design (BLK)
(Plasmid
#107789)
-
PurposemiR-30a RNAi Expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA6.2-GW/EmGFP
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5699
- Total vector size (bp) 5760
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMmu-miR-30a-5p mature sequence
-
Alt namemiR-30a
-
Alt namemiR-30a-5p
-
gRNA/shRNA sequenceGTTTTGGCCACTGACTGACCTTCCAGTAGGATGTTTACA
-
SpeciesM. musculus (mouse)
-
Entrez GeneMir30a (a.k.a. Mirn30a, mir-30a, mmu-mir-30a)
- Promoter CMV
-
Tag
/ Fusion Protein
- EmGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mmu-miR-30a-5p mature sequence was cloned following manufacturer’s instructions. It generates an artificial pre-miRNA, which matures to mmu-miR-30a-5p. Plasmid constructed by Marc Beltrà in the Penna lab.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mmu-miR-30a-5p Block-iT design (BLK) was a gift from Fabio Penna (Addgene plasmid # 107789 ; http://n2t.net/addgene:107789 ; RRID:Addgene_107789)