ilux pQE(-)
(Plasmid
#107880)
-
PurposeBacterial expression of ilux for bioluminescence imaging
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE(-)
- Backbone size w/o insert (bp) 3428
- Total vector size (bp) 10033
-
Modifications to backboneHis-deleted version of pQE30
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameilux
-
SpeciesSynthetic
-
Insert Size (bp)6605
- Promoter T5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer CGAGCGTTCTGAACAAATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid may exhibit instability in the T5 promoter region. It is recommended to verify this region by Sanger sequencing with AmpSeq-F 5'-ctcatgagcggatacatatttgaa-3'.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ilux pQE(-) was a gift from Stefan Hell (Addgene plasmid # 107880) -
For your References section:
Strongly enhanced bacterial bioluminescence with the ilux operon for single-cell imaging. Gregor C, Gwosch KC, Sahl SJ, Hell SW. Proc Natl Acad Sci U S A. 2018 Jan 30;115(5):962-967. doi: 10.1073/pnas.1715946115. Epub 2018 Jan 16. 10.1073/pnas.1715946115 PubMed 29339494