Skip to main content

Lifeact-rsLOV2 pcDNA3.1(+)
(Plasmid #107882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107882 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 5374
  • Total vector size (bp) 5875
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rsLOV2
  • Species
    Synthetic
  • Insert Size (bp)
    429
  • Promoter CMV
  • Tag / Fusion Protein
    • Lifeact (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lifeact-rsLOV2 pcDNA3.1(+) was a gift from Stefan Hell (Addgene plasmid # 107882 ; http://n2t.net/addgene:107882 ; RRID:Addgene_107882)
  • For your References section:

    Novel reversibly switchable fluorescent proteins for RESOLFT and STED nanoscopy engineered from the bacterial photoreceptor YtvA. Gregor C, Sidenstein SC, Andresen M, Sahl SJ, Danzl JG, Hell SW. Sci Rep. 2018 Feb 9;8(1):2724. doi: 10.1038/s41598-018-19947-1. 10.1038/s41598-018-19947-1 [pii] PubMed 29426833