P16ΔS:GFP1–9
(Plasmid
#108186)
-
PurposeBinary vectors used for the constitutive expression of tripartite split-sfGFP components (GFP1-9) in plants
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneP16ΔS:GFPc:Kan
-
Backbone manufacturerJörg Kudla
- Total vector size (bp) 12492
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP1-9
-
SpeciesSynthetic
-
Insert Size (bp)591
- Promoter P16ΔS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer Aagctttggaaccatcttttgggttcc
- 3′ sequencing primer TCGCGTATTAAATGTATAATTGCGGGACTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P16ΔS:GFP1–9 was a gift from Tzu-Yin Liu (Addgene plasmid # 108186 ; http://n2t.net/addgene:108186 ; RRID:Addgene_108186) -
For your References section:
Detection of membrane protein-protein interaction in planta based on dual intein-coupled tripartite split-GFP association. Liu TY, Chou WC, Chen WY, Chu CY, Dai CY, Wu PY. Plant J. 2018 Feb 16. doi: 10.1111/tpj.13874. 10.1111/tpj.13874 PubMed 29451720