pBV163
(Plasmid #108364)

• Purpose: Used to replace C. glabrata YAP1 promoter with the stronger TDH3 promoter.
• Depositing Lab: Scott Moye-Rowley
• Publication: Vu et al mSphere. 2018 Mar 28;3(2). pii: mSphere00099-18. doi: 10.1128/mSphere.00099-18. eCollection 2018 Mar-Apr.

Backbone

• Vector backbone: pFA6a
• Backbone size w/o insert (bp): 2648
• Total vector size (bp): 10207
• Vector type: Replace C.glabrata YAP1 promoter with C. glabrata TDH3 promoter
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Knock-in Cg TDH3 promoter in Cg YAP1 gene
• Species: S. cerevisiae (budding yeast), Synthetic; Candida glabrata
• Promoter: TDH3

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGGTTTTCCCAGTCACGACGTTG
• 3′ sequencing primer: AAACAGCTATGACCATGATTA

Resource Information

• Supplemental Documents:
  • pBV163 (pUC19-loxpnatcreloxp-TDH3-YAP1).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry