pBV163
(Plasmid
#108364)
-
PurposeUsed to replace C. glabrata YAP1 promoter with the stronger TDH3 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFA6a
- Backbone size w/o insert (bp) 2648
- Total vector size (bp) 10207
-
Vector typeReplace C.glabrata YAP1 promoter with C. glabrata TDH3 promoter
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKnock-in Cg TDH3 promoter in Cg YAP1 gene
-
SpeciesS. cerevisiae (budding yeast), Synthetic; Candida glabrata
- Promoter TDH3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGTTTTCCCAGTCACGACGTTG
- 3′ sequencing primer AAACAGCTATGACCATGATTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBV163 was a gift from Scott Moye-Rowley (Addgene plasmid # 108364 ; http://n2t.net/addgene:108364 ; RRID:Addgene_108364) -
For your References section:
Construction and Use of a Recyclable Marker To Examine the Role of Major Facilitator Superfamily Protein Members in Candida glabrata Drug Resistance Phenotypes. Vu BG, Moye-Rowley WS. mSphere. 2018 Mar 28;3(2). pii: mSphere00099-18. doi: 10.1128/mSphere.00099-18. eCollection 2018 Mar-Apr. 10.1128/mSphere.00099-18 PubMed 29600281