pLX303-PCDH7-a
(Plasmid
#108538)
-
PurposeExpresses human PCDH7 transcript variant a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108538 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX303
-
Backbone manufacturerDavid Root Lab, addgene #25897
- Backbone size w/o insert (bp) 9335
- Total vector size (bp) 10926
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCDH7 transcript variant a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3216
-
GenBank IDNM_002589.2
-
Entrez GenePCDH7 (a.k.a. BH-Pcdh, BHPCDH, PPP1R120)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX303-PCDH7-a was a gift from Kathryn O’Donnell (Addgene plasmid # 108538 ; http://n2t.net/addgene:108538 ; RRID:Addgene_108538) -
For your References section:
PROTOCADHERIN 7 Acts through SET and PP2A to Potentiate MAPK Signaling by EGFR and KRAS during Lung Tumorigenesis. Zhou X, Updegraff BL, Guo Y, Peyton M, Girard L, Larsen JE, Xie XJ, Zhou Y, Hwang TH, Xie Y, Rodriguez-Canales J, Villalobos P, Behrens C, Wistuba II, Minna JD, O'Donnell KA. Cancer Res. 2017 Jan 1;77(1):187-197. doi: 10.1158/0008-5472.CAN-16-1267-T. Epub 2016 Nov 7. 10.1158/0008-5472.CAN-16-1267-T PubMed 27821484