pLX304-PCDH7-c
(Plasmid
#108540)
-
PurposeExpresses human PCDH7 transcript variant c in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108540 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLX304
-
Backbone manufacturerDavid Root Lab, addgene #25890
- Backbone size w/o insert (bp) 9377
- Total vector size (bp) 11497
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCDH7 transcript variant c
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3748
-
GenBank IDNM_032457.3
-
Entrez GenePCDH7 (a.k.a. BH-Pcdh, BHPCDH, PPP1R120)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Full-length cDNA of PCDH7 transcript variant c, including the stop codon, was cloned into pLX304 vector (Addgene, #25890) to generate this construct. Therefore, although pLX304 has a downstream V5 tag coding sequence, the PCDH7 transcript variant c is NOT expressed as V5-tagged protein.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX304-PCDH7-c was a gift from Kathryn O’Donnell (Addgene plasmid # 108540 ; http://n2t.net/addgene:108540 ; RRID:Addgene_108540) -
For your References section:
PROTOCADHERIN 7 Acts through SET and PP2A to Potentiate MAPK Signaling by EGFR and KRAS during Lung Tumorigenesis. Zhou X, Updegraff BL, Guo Y, Peyton M, Girard L, Larsen JE, Xie XJ, Zhou Y, Hwang TH, Xie Y, Rodriguez-Canales J, Villalobos P, Behrens C, Wistuba II, Minna JD, O'Donnell KA. Cancer Res. 2017 Jan 1;77(1):187-197. doi: 10.1158/0008-5472.CAN-16-1267-T. Epub 2016 Nov 7. 10.1158/0008-5472.CAN-16-1267-T PubMed 27821484