pCS2 Halo-Tev- HSPB7 (zebrafish) WT
(Plasmid
#108916)
-
PurposeExpress WT Zebrafish Halo-Tev-HSPB7 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2
- Backbone size w/o insert (bp) 4697
- Total vector size (bp) 6065
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHalo-TEV-HSPB7
-
Alt nameHeat shock protein family B (small) member 7
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1401
-
Entrez Genehspb7 (a.k.a. zgc:103426)
- Promoter SP6
-
Tag
/ Fusion Protein
- Halo-TEV (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer gtggtttgtccaaactcatc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2 Halo-Tev- HSPB7 (zebrafish) WT was a gift from Yimon Aye (Addgene plasmid # 108916 ; http://n2t.net/addgene:108916 ; RRID:Addgene_108916) -
For your References section:
Cardiovascular Small Heat Shock Protein HSPB7 Is a Kinetically Privileged Reactive Electrophilic Species (RES) Sensor. Surya SL, Long MJC, Urul DA, Zhao Y, Mercer EJ, EIsaid IM, Evans T, Aye Y. ACS Chem Biol. 2018 Feb 8. doi: 10.1021/acschembio.7b00925. 10.1021/acschembio.7b00925 PubMed 29397684