Skip to main content
Addgene
Open Menu

pCS2 Halo-Tev- HSPB7 (zebrafish) WT
(Plasmid #108916)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108916 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 108916-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 108916-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCS2
  • Backbone size w/o insert (bp) 4697
  • Total vector size (bp) 6065
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Halo-TEV-HSPB7
  • Alt name
    Heat shock protein family B (small) member 7
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1401
  • Entrez Gene
    hspb7 (a.k.a. zgc:103426)
  • Promoter SP6
  • Tag / Fusion Protein
    • Halo-TEV (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer gtggtttgtccaaactcatc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2 Halo-Tev- HSPB7 (zebrafish) WT was a gift from Yimon Aye (Addgene plasmid # 108916 ; http://n2t.net/addgene:108916 ; RRID:Addgene_108916)

  • For your References section:

    Cardiovascular Small Heat Shock Protein HSPB7 Is a Kinetically Privileged Reactive Electrophilic Species (RES) Sensor. Surya SL, Long MJC, Urul DA, Zhao Y, Mercer EJ, EIsaid IM, Evans T, Aye Y. ACS Chem Biol. 2018 Feb 8. doi: 10.1021/acschembio.7b00925. 10.1021/acschembio.7b00925 PubMed 29397684
Related items:
Commonly requested with: