pLenti-X1-Neo-GFP-ATL2-deltaTM
(Plasmid
#109021)
-
Purposestable lentiviral expression of cDNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-X1-Neo
-
Backbone manufacturerMichael Rape
- Backbone size w/o insert (bp) 9005
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418) ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATL2-deltaTM
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2172
-
Mutationtruncated form without C-terminal ER transmembrane domain, delta477-583
-
Entrez GeneATL2 (a.k.a. ARL3IP2, ARL6IP2, aip-2, atlastin2)
- Promoter EIF-1a promoter
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCCTCAGACAGTGGTTCAA
- 3′ sequencing primer agcagcgtatccacatagcgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This ATL2 construct has suspected genomic instability and/or leaky expression that results in bacteria toxicity if grown at 37'C. We recommend bacteria culture at 30'C for 24-36hrs and in large batch for significant yield.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-X1-Neo-GFP-ATL2-deltaTM was a gift from Jacob Corn (Addgene plasmid # 109021 ; http://n2t.net/addgene:109021 ; RRID:Addgene_109021) -
For your References section:
Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524