pLenti-X1-Neo-GFP-ATL3
(Plasmid
#109024)
-
Purposestable lentiviral expression of cDNA
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti-X1-Neo
-
Backbone manufacturerMichael Rape
- Backbone size w/o insert (bp) 9005
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418) ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATL3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2313
-
Entrez GeneATL3 (a.k.a. HSN1F)
- Promoter EIF-1a promoter
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCCTCAGACAGTGGTTCAA
- 3′ sequencing primer agcagcgtatccacatagcgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-X1-Neo-GFP-ATL3 was a gift from Jacob Corn (Addgene plasmid # 109024 ; http://n2t.net/addgene:109024 ; RRID:Addgene_109024) -
For your References section:
Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524