Skip to main content

PtPuc3_diaCas9_sgRNA
(Plasmid #109219)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109219 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPtPuc3
  • Backbone manufacturer
    Addgene Plasmid 62863, Hamilton Smith Lab
  • Vector type
    CRISPR, Synthetic Biology
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    LHCF2 promoter
  • Species
    Phaeodactylum tricornutum
  • Insert Size (bp)
    442
  • GenBank ID
    Z24761.1
  • Promoter LHCF2 promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac1 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer ACACAGGAGTCTGGACTTGAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    diaCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4283
  • Promoter diaCas9

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TACGACGCTCGCTCCAGCTG
  • 3′ sequencing primer TCCCTGGTTGAGTTCGATAGCA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    LHCF1 terminator
  • Species
    Phaeodactylum tricornutum
  • Insert Size (bp)
    216
  • GenBank ID
    Z24761.1
  • Promoter LHCF1 terminator

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site Pst1 (not destroyed)
  • 5′ sequencing primer GTTTGTAGAACAGCATAAGCAC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    U6 promoter
  • Species
    Phaeodactylum tricornutum
  • Insert Size (bp)
    280
  • GenBank ID
    CM000611.1
  • Promoter U6 promoter

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pst1 (not destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer TTTCAGTGAGGACAAGAAGCTC
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    103
  • Promoter sgRNA

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer CACGCCAAGTATTCATTGTTAG
  • (Common Sequencing Primers)

Gene/Insert 6

  • Gene/Insert name
    U6 3' region
  • Species
    Phaeodactylum tricornutum
  • Insert Size (bp)
    330
  • GenBank ID
    CM000611.1
  • Promoter U6 3' region

Cloning Information for Gene/Insert 6

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CACGCCAAGTATTCATTGTTAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pPtPuc3 episome vector was obtained from Addgene, Plasmid 62863, Hamilton Smith Lab
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PtPuc3_diaCas9_sgRNA was a gift from Per Winge (Addgene plasmid # 109219 ; http://n2t.net/addgene:109219 ; RRID:Addgene_109219)
  • For your References section:

    Transgene-free genome editing in marine algae by bacterial conjugation - comparison with biolistic CRISPR/Cas9 transformation. Sharma AK, Nymark M, Sparstad T, Bones AM, Winge P. Sci Rep. 2018 Sep 26;8(1):14401. doi: 10.1038/s41598-018-32342-0. 10.1038/s41598-018-32342-0 PubMed 30258061