Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET29b-RupA_T2-R-CHis
(Plasmid #109258)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109258 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET29b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5370
  • Total vector size (bp) 6810
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RupA_T2-R
  • Species
    Ruminococcus bromii
  • Insert Size (bp)
    1515
  • Mutation
    contains aa 1939..2443 of WP_015523502.1
  • GenBank ID
    NC_021013.1 WP_015523502.1
  • Promoter T7
  • Tags / Fusion Proteins
    • His tag (C terminal on backbone)
    • S-Tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29b-RupA_T2-R-CHis was a gift from Emily Balskus (Addgene plasmid # 109258 ; http://n2t.net/addgene:109258 ; RRID:Addgene_109258)
  • For your References section:

    Discovery of small molecule protease inhibitors by investigating a widespread human gut bacterial biosynthetic pathway,. Schneider BA, EP Balskus. Tetrahedron 10.1016/j.tet.2018.03.043