pEM705 Gs15
(Plasmid
#109360)
-
PurposeGsX chimera with Gα15 C-terminus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEM705
- Backbone size w/o insert (bp) 6002
- Total vector size (bp) 7184
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGs15 chimera
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1182
-
GenBank ID
- Promoter CAG
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttctggcgtgtgaccggcggctc
- 3′ sequencing primer TTGGCAGAGGGAAAAAGATCTCAGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM705 Gs15 was a gift from Robert Lucas (Addgene plasmid # 109360 ; http://n2t.net/addgene:109360 ; RRID:Addgene_109360) -
For your References section:
A live cell assay of GPCR coupling allows identification of optogenetic tools for controlling Go and Gi signaling. Ballister ER, Rodgers J, Martial F, Lucas RJ. BMC Biol. 2018 Jan 16;16(1):10. doi: 10.1186/s12915-017-0475-2. 10.1186/s12915-017-0475-2 PubMed 29338718