Skip to main content
Addgene

pcDNA3 Rod Opsin
(Plasmid #109361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109361 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5374
  • Total vector size (bp) 6421
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rod opsin
  • Alt name
    Rho
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1047
  • GenBank ID
    NM_000539.3
  • Entrez Gene
    RHO (a.k.a. CSNBAD1, OPN2, RP4)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer ggcaccttccagggtcaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Construction of pcDNA3 Rod opsin plasmid is described in full in Bailes & Lucas (2013) Proc. Biol. Sci. doi: 10.1098/rspb.2012.2987

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 Rod Opsin was a gift from Robert Lucas (Addgene plasmid # 109361 ; http://n2t.net/addgene:109361 ; RRID:Addgene_109361)
  • For your References section:

    A live cell assay of GPCR coupling allows identification of optogenetic tools for controlling Go and Gi signaling. Ballister ER, Rodgers J, Martial F, Lucas RJ. BMC Biol. 2018 Jan 16;16(1):10. doi: 10.1186/s12915-017-0475-2. 10.1186/s12915-017-0475-2 [pii] PubMed 29338718