Skip to main content

pcDNA3 Rod Opsin
(Plasmid #109361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109361 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5374
  • Total vector size (bp) 6421
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rod opsin
  • Alt name
    Rho
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1047
  • GenBank ID
    NM_000539.3
  • Entrez Gene
    RHO (a.k.a. CSNBAD1, OPN2, RP4)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer ggcaccttccagggtcaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also see Ballister et al. BMC Biol. 2018 (doi: 10.1186/s12915-017-0475-2) for additional use.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 Rod Opsin was a gift from Robert Lucas (Addgene plasmid # 109361 ; http://n2t.net/addgene:109361 ; RRID:Addgene_109361)
  • For your References section:

    Human melanopsin forms a pigment maximally sensitive to blue light (lambdamax approximately 479 nm) supporting activation of G(q/11) and G(i/o) signalling cascades. Bailes HJ, Lucas RJ. Proc Biol Sci. 2013 Apr 3;280(1759):20122987. doi: 10.1098/rspb.2012.2987. Print 2013 May 22. 10.1098/rspb.2012.2987 PubMed 23554393