-
PurposeHuman rod opsin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5374
- Total vector size (bp) 6421
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRod opsin
-
Alt nameRho
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1047
-
GenBank IDNM_000539.3
-
Entrez GeneRHO (a.k.a. CSNBAD1, OPN2, RP4)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
- 3′ sequencing primer ggcaccttccagggtcaagg
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also see Ballister et al. BMC Biol. 2018 (doi: 10.1186/s12915-017-0475-2) for additional use.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 Rod Opsin was a gift from Robert Lucas (Addgene plasmid # 109361 ; http://n2t.net/addgene:109361 ; RRID:Addgene_109361) -
For your References section:
Human melanopsin forms a pigment maximally sensitive to blue light (lambdamax approximately 479 nm) supporting activation of G(q/11) and G(i/o) signalling cascades. Bailes HJ, Lucas RJ. Proc Biol Sci. 2013 Apr 3;280(1759):20122987. doi: 10.1098/rspb.2012.2987. Print 2013 May 22. 10.1098/rspb.2012.2987 PubMed 23554393