pMIA3
(Plasmid
#109399)
-
Purpose(Empty Backbone) Expresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSB
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx330 (addgene #42230)
- Backbone size (bp) 4000
-
Modifications to backbonePromoter was changed to EF1a and pUC fragment was modified.
-
Vector typeMammalian Expression, CRISPR
- Promoter EF1a
-
Tags
/ Fusion Proteins
- mRuby2 (N terminal on insert)
- mtp53dn (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byeSpCas9 is modified from px330 with the point mutations described by Slaymaker et.al., Science, (2016) using a gBlock. mRuby2 was amplified from a gBlock based on the sequence from Lam et al., Nat Meth, (2012) and mtp53 was amplified from Addgene plasmid #41856.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pMIA3 allows for higher survival of hES cells after Cas9 DSB targeting, and thus reduces the number for clones required to screen for desired editing.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIA3 was a gift from Roger Foo (Addgene plasmid # 109399 ; http://n2t.net/addgene:109399 ; RRID:Addgene_109399) -
For your References section:
A Roadmap for Human Liver Differentiation from Pluripotent Stem Cells. Ang LT, Tan AKY, Autio MI, Goh SH, Choo SH, Lee KL, Tan J, Pan B, Lee JJH, Lum JJ, Lim CYY, Yeo IKX, Wong CJY, Liu M, Oh JLL, Chia CPL, Loh CH, Chen A, Chen Q, Weissman IL, Loh KM, Lim B. Cell Rep. 2018 Feb 20;22(8):2190-2205. doi: 10.1016/j.celrep.2018.01.087. 10.1016/j.celrep.2018.01.087 PubMed 29466743