This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

plenti-CMV-mCherry-T2A-GFP
(Plasmid #109427)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109427 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HIV-1 NL4-3
  • Backbone size w/o insert (bp) 9268
  • Modifications to backbone
    Removed gag-pol, vif, vpr, and part of env from HIV-1 NL4-3 backbone. Inserted mCherry T2A GFP.
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry T2A GFP
  • Species
    Synthetic
  • Insert Size (bp)
    1503
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CTGGCTACCGGTATGGTGAGCAAGGGCGAGG
  • 3′ sequencing primer CTTGTACTCGAGATCTGCACCGGGCTTGTACAGCTCGTCCATGCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plenti-CMV-mCherry-T2A-GFP was a gift from Reuben Harris (Addgene plasmid # 109427 ; http://n2t.net/addgene:109427 ; RRID:Addgene_109427)
  • For your References section:

    A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667