ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
(Plasmid
#109428)
-
PurposeA lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 109428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneHIV-1 NL4-3
- Backbone size w/o insert (bp) 9269
- Total vector size (bp) 10814
-
Modifications to backboneRemoved HIV-1 nef, vif, vpr, and part of env. Inserted CMV mCherry T2A GFP with a 43 base pair insertion in mCherry.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry T2A GFP
-
SpeciesSynthetic
-
Insert Size (bp)1545
-
MutationInserted 43 base pairs into mCherry to create reporter
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ctggctaccggtatggtgagcaagggcgagg
- 3′ sequencing primer CTTGTACTCGAGATCTGCACCGGGCTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP) was a gift from Reuben Harris (Addgene plasmid # 109428 ; http://n2t.net/addgene:109428 ; RRID:Addgene_109428) -
For your References section:
A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667