Halo-Tev-Flag-Ube2v1
(Plasmid
#110069)
-
PurposeExpress Halo-Tev-Flag-Ube2v1 (human) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepfn21a
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3760
- Total vector size (bp) 5236
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHalo-Tev-Flag-Ube2v1
-
Alt nameUbiquitin-conjugating enzyme E2 variant 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1476
-
Entrez GeneUBE2V1 (a.k.a. CIR1, CROC-1, CROC1, UBE2V, UEV-1, UEV1, UEV1A)
- Promoter T7
-
Tag
/ Fusion Protein
- Halo-TEV-Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCAAAGCCACCATGGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAG
- 3′ sequencing primer CCGAGCCCGAATTCGTTTAATTGCTGTAACACTGTCCTTCGGGCGGCTGAGGGAGTTTCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-Tev-Flag-Ube2v1 was a gift from Yimon Aye (Addgene plasmid # 110069 ; http://n2t.net/addgene:110069 ; RRID:Addgene_110069) -
For your References section:
Ube2V2 Is a Rosetta Stone Bridging Redox and Ubiquitin Codes, Coordinating DNA Damage Responses. Zhao Y, Long MJC, Wang Y, Zhang S, Aye Y. ACS Cent Sci. 2018 Feb 28;4(2):246-259. doi: 10.1021/acscentsci.7b00556. Epub 2018 Jan 17. 10.1021/acscentsci.7b00556 PubMed 29532025