pET29b-pduCDE
(Plasmid
#110138)
-
PurposeExpresses B12-dependent propanediol dehydratase in E. coli BL21(DE3)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET-29 b (+)
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5238
- Total vector size (bp) 8124
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29b-pduCDE was a gift from Emily Balskus (Addgene plasmid # 110138 ; http://n2t.net/addgene:110138 ; RRID:Addgene_110138) -
For your References section:
Characterization of 1,2-Propanediol Dehydratases Reveals Distinct Mechanisms for B12-Dependent and Glycyl Radical Enzymes. Levin BJ, Balskus EP. Biochemistry. 2018 Mar 16. doi: 10.1021/acs.biochem.8b00164. 10.1021/acs.biochem.8b00164 PubMed 29526088