Skip to main content

pET29b-pduCDE
(Plasmid #110138)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110138 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-29 b (+)
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5238
  • Total vector size (bp) 8124
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pduCDE
  • Alt name
    B12-PD
  • Alt name
    B12-Dependent Propanediol Dehydratase
  • Species
    Klebsiella oxytoca ATCC 8724
  • Insert Size (bp)
    2886
  • GenBank ID
  • Entrez Gene
    pduE (a.k.a. KOX_01465)
  • Entrez Gene
    pduD (a.k.a. KOX_01460)
  • Entrez Gene
    pduC (a.k.a. KOX_01455)
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29b-pduCDE was a gift from Emily Balskus (Addgene plasmid # 110138 ; http://n2t.net/addgene:110138 ; RRID:Addgene_110138)
  • For your References section:

    Characterization of 1,2-Propanediol Dehydratases Reveals Distinct Mechanisms for B12-Dependent and Glycyl Radical Enzymes. Levin BJ, Balskus EP. Biochemistry. 2018 Mar 16. doi: 10.1021/acs.biochem.8b00164. 10.1021/acs.biochem.8b00164 PubMed 29526088