pET29b-PD-H166Q
(Plasmid #110179)

• Purpose: Expresses propanediol dehydratase mutant H166Q in E. coli BL21(DE3)
• Depositing Lab: Emily Balskus
• Publication: Levin et al Science. 2017 Feb 10;355(6325). pii: 355/6325/eaai8386. doi: 10.1126/science.aai8386.

Backbone

• Vector backbone: pET-29 b (+)
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5299
• Total vector size (bp): 7830
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Propanediol Dehydratase
• Alt name: PD
• Alt name: B12-Independent Propanediol Dehydratase
• Species: Roseburia inulinivorans strain A2-194
• Insert Size (bp): 2530
• Mutation: H166Q mutant
• GenBank ID: WP_007885173.1
• Promoter: T7
• Tags / Fusion Proteins:
  • S-tag (N terminal on backbone)
  • His6 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry