pSV272-PfMBP-HypDAE
(Plasmid
#110296)
-
PurposeExpresses t-4-hydroxy-L-proline dehydratase activating enzyme in E. coli BL21(DE3)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSV-PfMBP
-
Backbone manufacturerStubbe Lab (see DOI:10.1021/acs.biochem.5b01092)
- Backbone size w/o insert (bp) 6575
- Total vector size (bp) 7484
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namet-4-Hydroxy-L-proline Dehydratase Activating Enzyme
-
Alt nameHypD-AE
-
Alt namet4LHypD-AE
-
SpeciesClostridium difficile 70-100-2010
-
Insert Size (bp)909
-
GenBank IDWP_102822675.1
- Promoter T7
-
Tags
/ Fusion Proteins
- His6 (N terminal on backbone)
- Maltose Binding Protein (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSV272-PfMBP-HypDAE was a gift from Emily Balskus (Addgene plasmid # 110296 ; http://n2t.net/addgene:110296 ; RRID:Addgene_110296) -
For your References section:
A prominent glycyl radical enzyme in human gut microbiomes metabolizes trans-4-hydroxy-l-proline. Levin BJ, Huang YY, Peck SC, Wei Y, Martinez-Del Campo A, Marks JA, Franzosa EA, Huttenhower C, Balskus EP. Science. 2017 Feb 10;355(6325). pii: 355/6325/eaai8386. doi: 10.1126/science.aai8386. 10.1126/science.aai8386 PubMed 28183913