Skip to main content

pQC MCS IRES Puro
(Plasmid #110343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110343 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQC mKorange IX
  • Backbone manufacturer
    #37344
  • Backbone size (bp) 7013
  • Modifications to backbone
    Puromycin resistance from pLKO.1 - TRC cloning vector (Addgene #10878) were removed with BamHI and KpnI and blunted to fit EcoRV site from pQC mKorange IX (Addgene #37344). AgeI and EcoRI sites were also used to replace mKorange with synthetic MCS derived from annealed oligos (5' CCGGGGATCCGGTTCTAGAGCCACCGGTTGTATGGAGTTTAAACTCCAAAGCATCGATGGTAGCGGCCGCGGTGAATTCTGATT 3' and 5' AATTAATCAGAATTCACCGCGGCCGCTACCATCGATGCTTTGGAGTTTAAACTCCATACAACCGGTGGCTCTAGAACCGGATCC 3')
  • Vector type
    Mammalian Expression, Retroviral
  • Promoter CMV
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer pQC Seq Fow 5'-ACGCCATCCACGCTGTTTTGACCT-3'
  • 3′ sequencing primer pQC Seq Rev 5'-AAGCGGCTTCGGCCAGTAACGTTA-3'
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Used sequences from pQC mKorange IX (Addgene #37344), Dr. Connie Cepko and pLKO.1 - TRC cloning vector (Addgene #10878), Dr. David Root

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pQC-based γ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.

Also available as:
V5-mKO2-MCS-IRES-Puro (Addgene #110341)
V5 MCS IRES Puro (Addgene #110342)
MCS IRES Puro (Addgene #110343)
MCS IRES G418 (Addgene #110344)
V5 MCS IRES G418 (Addgene #110345)

All vectors can be used for TA-cloning (After XcmI cleavage), or BamHI-AgeI-PmeI-EcoRI restriction cloning.

Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQC MCS IRES Puro was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110343 ; http://n2t.net/addgene:110343 ; RRID:Addgene_110343)
  • For your References section:

    Molecular mechanism of glutaminase activation through filamentation and the role of filaments in mitophagy protection. Adamoski D, Dias MM, Quesnay JEN, Yang Z, Zagoriy I, Steyer AM, Rodrigues CT, da Silva Bastos AC, da Silva BN, Costa RKE, de Abreu FMO, Islam Z, Cassago A, van Heel MG, Consonni SR, Mattei S, Mahamid J, Portugal RV, Ambrosio ALB, Dias SMG. Nat Struct Mol Biol. 2023 Dec;30(12):1902-1912. doi: 10.1038/s41594-023-01118-0. Epub 2023 Oct 19. 10.1038/s41594-023-01118-0 PubMed 37857822