Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQC MCS IRES Puro
(Plasmid #110343)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110343 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQC mKorange IX
  • Backbone manufacturer
    #37344
  • Backbone size (bp) 7013
  • Modifications to backbone
    Puromycin resistance from pLKO.1 - TRC cloning vector (Addgene #10878) were removed with BamHI and KpnI and blunted to fit EcoRV site from pQC mKorange IX (Addgene #37344). AgeI and EcoRI sites were also used to replace mKorange with synthetic MCS derived from annealed oligos (5' CCGGGGATCCGGTTCTAGAGCCACCGGTTGTATGGAGTTTAAACTCCAAAGCATCGATGGTAGCGGCCGCGGTGAATTCTGATT 3' and 5' AATTAATCAGAATTCACCGCGGCCGCTACCATCGATGCTTTGGAGTTTAAACTCCATACAACCGGTGGCTCTAGAACCGGATCC 3')
  • Vector type
    Mammalian Expression, Retroviral
  • Promoter CMV
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer pQC Seq Fow 5'-ACGCCATCCACGCTGTTTTGACCT-3'
  • 3′ sequencing primer pQC Seq Rev 5'-AAGCGGCTTCGGCCAGTAACGTTA-3'
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Used sequences from pQC mKorange IX (Addgene #37344), Dr. Connie Cepko and pLKO.1 - TRC cloning vector (Addgene #10878), Dr. David Root
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

pQC-based γ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.

Also available as:
V5-mKO2-MCS-IRES-Puro (Addgene #110341)
V5 MCS IRES Puro (Addgene #110342)
MCS IRES Puro (Addgene #110343)
MCS IRES G418 (Addgene #110344)
V5 MCS IRES G418 (Addgene #110345)

All vectors can be used for TA-cloning (After XcmI cleavage), or BamHI-AgeI-PmeI-EcoRI restriction cloning.

Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQC MCS IRES Puro was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110343 ; http://n2t.net/addgene:110343 ; RRID:Addgene_110343)