psiCHECK2 3'UTR KGA
(Plasmid
#110402)
-
PurposeLuminescence-based glutaminase KGA isoform 3'UTR-mediated RNA stability reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepsiCHECK2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6278
- Total vector size (bp) 8803
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGLS glutaminase
-
Alt nameIsoform GAC 3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2549
-
Entrez GeneGLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCCTCCACTTCAGCCAGGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2 3'UTR KGA was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110402 ; http://n2t.net/addgene:110402 ; RRID:Addgene_110402)