pX330.puro sgRNA KGA Stop1
(Plasmid
#110405)
-
PurposeCRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330.puro
-
Backbone manufacturer#110403
- Backbone size w/o insert (bp) 9906
- Total vector size (bp) 9909
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGLS glutaminase
-
gRNA/shRNA sequenceATCTTGATGGATTGTTGTAA
-
SpeciesH. sapiens (human)
-
Entrez GeneGLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
- Promoter CBh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA for GLS exon 19 (KGA isoform stop codon), intended to perform C-Terminal knock-in using pX330 with puromycin resistance.
System options:
sgRNA:
pX330.puro sgRNA KGA Stop1 (Addgene #110405)
Homology arms:
pUC19 KGA HA5'-mKO2-3' (Addgene #110406)
pUC19 KGA HA5'-mKO2-P2A-3' (Addgene #110407)
pUC19 KGA HA5'-mKO2-P2A-Zeo-3' (Addgene #110408)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330.puro sgRNA KGA Stop1 was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110405 ; http://n2t.net/addgene:110405 ; RRID:Addgene_110405)