Skip to main content
Addgene

pX330.puro sgRNA KGA Stop1
(Plasmid #110405)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110405 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330.puro
  • Backbone manufacturer
    #110403
  • Backbone size w/o insert (bp) 9906
  • Total vector size (bp) 9909
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLS glutaminase
  • gRNA/shRNA sequence
    ATCTTGATGGATTGTTGTAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    GLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sgRNA for GLS exon 19 (KGA isoform stop codon), intended to perform C-Terminal knock-in using pX330 with puromycin resistance.

System options:
sgRNA:
pX330.puro sgRNA KGA Stop1 (Addgene #110405)

Homology arms:
pUC19 KGA HA5'-mKO2-3' (Addgene #110406)
pUC19 KGA HA5'-mKO2-P2A-3' (Addgene #110407)
pUC19 KGA HA5'-mKO2-P2A-Zeo-3' (Addgene #110408)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330.puro sgRNA KGA Stop1 was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110405 ; http://n2t.net/addgene:110405 ; RRID:Addgene_110405)