pYZ011
(Plasmid
#110570)
-
Purposeexpression of GST-mSTH(A14Q)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-4t1
-
Backbone manufacturerGE
- Backbone size w/o insert (bp) 4969
- Total vector size (bp) 5047
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesta2
-
Alt namelinker sequence + mature ST-H sequence from H10407
-
Alt namefrom heat-stable enterotoxin A2 precursor (STA2)
-
SpeciesEscherichia coli ETEC H10407
-
Insert Size (bp)87
-
MutationGCT codon corresponding to Amino Acid 14 of the mature ST-H peptide on pCW002 was mutated to CAA leading to an A14Q mutation on the new plasmid
-
GenBank IDNC_017724.1
- Promoter pTac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer AGCGGATAACAATTTCACACAGG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYZ011 was a gift from James Fleckenstein (Addgene plasmid # 110570) -
For your References section:
Molecular determinants of enterotoxigenic Escherichia coli heat-stable toxin secretion and delivery. Zhu Y, Luo Q, Davis SM, Westra C, Vickers TJ, Fleckenstein JM. Infect Immun. 2018 Aug 20. pii: IAI.00526-18. doi: 10.1128/IAI.00526-18. 10.1128/IAI.00526-18 PubMed 30126899