Skip to main content

pYZ011
(Plasmid #110570)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110570 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-4t1
  • Backbone manufacturer
    GE
  • Backbone size w/o insert (bp) 4969
  • Total vector size (bp) 5047
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sta2
  • Alt name
    linker sequence + mature ST-H sequence from H10407
  • Alt name
    from heat-stable enterotoxin A2 precursor (STA2)
  • Species
    Escherichia coli ETEC H10407
  • Insert Size (bp)
    87
  • Mutation
    GCT codon corresponding to Amino Acid 14 of the mature ST-H peptide on pCW002 was mutated to CAA leading to an A14Q mutation on the new plasmid
  • GenBank ID
    NC_017724.1
  • Promoter pTac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYZ011 was a gift from James Fleckenstein (Addgene plasmid # 110570)
  • For your References section:

    Molecular determinants of enterotoxigenic Escherichia coli heat-stable toxin secretion and delivery. Zhu Y, Luo Q, Davis SM, Westra C, Vickers TJ, Fleckenstein JM. Infect Immun. 2018 Aug 20. pii: IAI.00526-18. doi: 10.1128/IAI.00526-18. 10.1128/IAI.00526-18 PubMed 30126899