Human HUWE1 (3993-4374)
(Plasmid
#110754)
-
PurposeBacterial Expression of HUWE1 HECT domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerMerck
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHUWE1
-
SpeciesH. sapiens (human)
-
Entrez GeneHUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MRXST, MULE, URE-B1, UREB1)
- Promoter T7
-
Tag
/ Fusion Protein
- N-His6-3C (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGGTTATGCTAGTTATTGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHUWE1: cDNA plasmid (provided by Thomas Mund, LMB)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human HUWE1 (3993-4374) was a gift from David Komander (Addgene plasmid # 110754 ; http://n2t.net/addgene:110754 ; RRID:Addgene_110754) -
For your References section:
Ubiquitin Linkage-Specific Affimers Reveal Insights into K6-Linked Ubiquitin Signaling. Michel MA, Swatek KN, Hospenthal MK, Komander D. Mol Cell. 2017 Oct 5;68(1):233-246.e5. doi: 10.1016/j.molcel.2017.08.020. Epub 2017 Sep 21. 10.1016/j.molcel.2017.08.020 PubMed 28943312