This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Human HUWE1 (3993-4374)
(Plasmid #110754)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110754 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HUWE1
  • Species
    H. sapiens (human)
  • Entrez Gene
    HUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MULE, URE-B1, UREB1)
  • Promoter T7
  • Tag / Fusion Protein
    • N-His6-3C (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human HUWE1 (3993-4374) was a gift from David Komander (Addgene plasmid # 110754 ; http://n2t.net/addgene:110754 ; RRID:Addgene_110754)
  • For your References section:

    Ubiquitin Linkage-Specific Affimers Reveal Insights into K6-Linked Ubiquitin Signaling. Michel MA, Swatek KN, Hospenthal MK, Komander D. Mol Cell. 2017 Oct 5;68(1):233-246.e5. doi: 10.1016/j.molcel.2017.08.020. Epub 2017 Sep 21. 10.1016/j.molcel.2017.08.020 PubMed 28943312