pCMV/myc/ER-αT9ib
(Plasmid
#110768)
-
PurposeExpresses ER intrabody against mouse and human TLR9
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA/myc/ER
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5044
- Total vector size (bp) 5066
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameintrabody against mouse and human TLR9
-
Alt nameαT9ib
-
Alt nameHuman/murine TLR9-cross-reactive intrabody
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)738
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc epitope tag (C terminal on backbone)
- ER retention signal (SEKDEL) (C terminal on backbone)
- ER signal peptide (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV/myc/ER-αT9ib was a gift from Thomas Böldicke (Addgene plasmid # 110768 ; http://n2t.net/addgene:110768 ; RRID:Addgene_110768) -
For your References section:
Molecular cloning and characterization of a novel anti-TLR9 intrabody. Reimer E, Somplatzki S, Zegenhagen D, Hanel S, Fels A, Bollhorst T, Hovest LG, Bauer S, Kirschning CJ, Boldicke T. Cell Mol Biol Lett. 2013 Sep;18(3):433-46. doi: 10.2478/s11658-013-0098-8. Epub 2013 Jul 26. 10.2478/s11658-013-0098-8 PubMed 23893288