pCMV/myc/ER-αT2ib
(Plasmid #110769)

• Purpose: Expresses ER intrabody against mouse and human TLR2
• Depositing Lab: Thomas Böldicke
• Publication: Kirschning et al BMC Biotechnol. 2010 Apr 13;10:31. doi: 10.1186/1472-6750-10-31.

Backbone

• Vector backbone: pcDNA/myc/ER
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5044
• Total vector size (bp): 5066
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: intrabody against mouse and human TLR2
• Alt name: scFv TLR2 10.1
• Alt name: Human/murine TLR2-cross-reactive intrabody
• Alt name: αT2ib
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 735
• Promoter: CMV
• Tags / Fusion Proteins:
  • myc epitope tag (C terminal on backbone)
  • ER retention signal (SEKDEL) (C terminal on backbone)
  • ER signal peptide (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry