pCMV/myc/ER-αT2ib
(Plasmid
#110769)
-
PurposeExpresses ER intrabody against mouse and human TLR2
-
Depositing Lab
-
Depositing OrganizationHelmholtz-Zentrum fuer Infektionsforschung (HZI)
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA/myc/ER
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5044
- Total vector size (bp) 5066
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameintrabody against mouse and human TLR2
-
Alt namescFv TLR2 10.1
-
Alt nameHuman/murine TLR2-cross-reactive intrabody
-
Alt nameαT2ib
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)735
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc epitope tag (C terminal on backbone)
- ER retention signal (SEKDEL) (C terminal on backbone)
- ER signal peptide (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV/myc/ER-αT2ib was a gift from Thomas Böldicke (Addgene plasmid # 110769 ; http://n2t.net/addgene:110769 ; RRID:Addgene_110769) -
For your References section:
Generation of anti-TLR2 intrabody mediating inhibition of macrophage surface TLR2 expression and TLR2-driven cell activation. Kirschning CJ, Dreher S, Maass B, Fichte S, Schade J, Koster M, Noack A, Lindenmaier W, Wagner H, Boldicke T. BMC Biotechnol. 2010 Apr 13;10:31. doi: 10.1186/1472-6750-10-31. 10.1186/1472-6750-10-31 PubMed 20388199